Top » Catalog » SNPs » BY71464

$18.00

BY71464
[BY71464]

BY71464
hg38 Position: ChrY:8426286..8426286
Ancestral: T
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: BY71464_F ATCACTTAGGTCATGAGCTCAGAC
Reverse Primer: BY71464_R CAGGCACACCAAACTTATTGC
Reviews

Customers who bought this product also purchased
BY108126
BY108126
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies