Top » Catalog » SNPs » BY71464

$18.00

BY71464
[BY71464]

BY71464
hg38 Position: ChrY:8426286..8426286
Ancestral: T
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: BY71464_F ATCACTTAGGTCATGAGCTCAGAC
Reverse Primer: BY71464_R CAGGCACACCAAACTTATTGC
Reviews

Customers who bought this product also purchased
BY108126
BY108126
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies