Top » Catalog » SNPs » FTA83125

$18.00

FTA83125
[FTA83125]

FTA83125
hg38 Position: ChrY:16135928..16135928
Ancestral: C
Derived: A
Reference: FTDNA (2021)
ISOGG Haplogroup: E
Comments: .
Forward Primer: FTA83125_F ATCATTTTCTCAGGAAACTGTGTATATG
Reverse Primer: FTA83125_R GCATCTATGGAAGATGTACCATCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies