Top » Catalog » SNPs » FT358839

$18.00

FT358839
[FT358839]

FT358839
hg38 Position: ChrY:16921669..16921669
Ancestral: A
Derived: T
Reference: FTDNA (2020)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FT358839_F CATATTCAAATGAGGGAAACCATC
Reverse Primer: FT358839_R AAGTAGAAAGAGGCTTAGAGTCAAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies