Top » Catalog » SNPs » Y53588

$18.00

Y53588
[Y53588]

Y53588
hg38 Position: ChrY:15580810..15580810
Ancestral: G
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: R1a
Comments: Below M459 > YP1272 > Y12640
Forward Primer: Y53588_F ACCCCTGTGAGGAATGAGTG
Reverse Primer: Y53588_R GAGCCACTAAATTCATGGTCAACT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies