Top » Catalog » SNPs » Y158967

$18.00

Y158967
[Y158967]

Y158967
hg38 Position: ChrY:22225163..22225163
Ancestral: G
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: E1b
Comments: Below M84 > Y5436 > Y66296
Forward Primer: Y158967_F CAAAGTATTCTGCCCAATCGG
Reverse Primer: Y158967_R AGTAAAATAAAATAAAATATATGTGGATTTTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies