Top » Catalog » SNPs » FT353138

$18.00

FT353138
[FT353138]

FT353138
hg38 Position: ChrY:16561421..16561421
Ancestral: T
Derived: A
Reference: FTDNA (2020)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: FT353138_F TCGGGCACAAATGCATG
Reverse Primer: FT353138_R GAACATTGTGACATGATTACCAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies