Top » Catalog » SNPs » FTA28497

$18.00

FTA28497
[FTA28497]

FTA28497
hg38 Position: ChrY:14919449..14919449
Ancestral: C
Derived: T
Reference: FTDNA (2021)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: FTA28497_F TTCTCAAATATTTGATAGTGAAAACAAAG
Reverse Primer: FTA28497_R AACAGCAGCATTTGGTTAACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies