Top » Catalog » SNPs » BY111221

$18.00

BY111221
[BY111221]

BY111221
hg38 Position: ChrY:14822858..14822858
Ancestral: A
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY111221_F TTGAAAATCTTCACGATCCTCTG
Reverse Primer: BY111221_R TGCTTTAAGCCCTAAAATAACATAAATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies