Top » Catalog » SNPs » FT383096

$18.00

FT383096
[FT383096]

FT383096
hg38 Position: ChrY:15300960..15300960
Ancestral: G
Derived: A
Reference: FTDNA (2020)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: FT383096_F CTTGGCCTCAAGCAATTCTC
Reverse Primer: FT383096_R GAGGAGCAAAGTCACATGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies