Top » Catalog » SNPs » Y126811

$18.00

Y126811
[Y126811]

Y126811
hg38 Position: ChrY:20304232..20304232
Ancestral: T
Derived: A
Reference: YFull (2020)
ISOGG Haplogroup: E1b
Comments: Within DYZ19
Forward Primer: Y126811_F TTCATGGTCTTGCTCACTTCC
Reverse Primer: Y126811_R TGAATCTGCCAGAAGGAAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies