Top » Catalog » SNPs » FTA50666

$18.00

FTA50666
[FTA50666]

FTA50666
hg38 Position: ChrY:16099897..16099897
Ancestral: A
Derived: G
Reference: FTDNA (2021)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FTA50666_F CAGAGGGGCCTGACCTTC
Reverse Primer: FTA50666_R GCATTCTTCCCATTGATTGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Z13768
$18.00
Haplogroup Info
Other products
Currencies