Top » Catalog » SNPs » BY122668

$18.00

BY122668
[BY122668]

BY122668
hg38 Position: ChrY:16513760..16513760
Ancestral: T
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY122668_F TTTACATCCAATTTTGTGGTCAAC
Reverse Primer: BY122668_R ATCATAATGACAGGATCAAATTCATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies