Top » Catalog » SNPs » A9005

$18.00

A9005
[A9005]

A9005
hg38 Position: ChrY:21045063..21045063
Ancestral: G
Derived: T
Reference: James Kane (2015)
ISOGG Haplogroup: R1b1a2a1a2c1c2a1
Comments: Downstream of S1121
Forward Primer: A9005_F GGTGCTCAGTGAAGGAGGG
Reverse Primer: A9005_R AGTATGTTTATATTGATGGGTTTCCTG
Reviews

Customers who bought this product also purchased
S1121
S1121
A664
A664
S1115
S1115
Z17981
Z17981
R1b-FGC11134 Panel (including CTS4466)
R1b-FGC11134 Panel (including CTS4466)
A159
A159
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies