Top » Catalog » SNPs » A9005

$18.00

A9005
[A9005]

A9005
hg38 Position: ChrY:21045063..21045063
Ancestral: G
Derived: T
Reference: James Kane (2015)
ISOGG Haplogroup: R1b1a2a1a2c1c2a1
Comments: Downstream of S1121
Forward Primer: A9005_F GGTGCTCAGTGAAGGAGGG
Reverse Primer: A9005_R AGTATGTTTATATTGATGGGTTTCCTG
Reviews

Customers who bought this product also purchased
BY3863
BY3863
FT43021
FT43021
BY39364
BY39364
Z16521
Z16521
BY39361
BY39361
FGC29280
FGC29280
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies