Top » Catalog » SNPs » FGC3268

$18.00

FGC3268
[FGC3268]

FGC3268
hg38 Position: ChrY:26367055..26367055
Ancestral: T
Derived: A
Reference: Robert McClure
ISOGG Haplogroup: R1b1a1a2a1a2c1f3~
Comments: Found in a R1b person
Forward Primer: FGC3268_F ATTCCTTCTATTTTCCCCTAGCCTA
Reverse Primer: FGC3268_R CAGGAGAACCACTTGAAGCTG
Reviews

Customers who bought this product also purchased
PF825.2
PF825.2
FGC3250
FGC3250
L430
L430
R1b-PF825.2 downstream
R1b-PF825.2 downstream
FGC3248
FGC3248
L1495
L1495
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies