Top » Catalog » SNPs » A9019

$18.00

A9019
[A9019]

A9019
hg38 Position: ChrY:11951846..11951846
Ancestral: C
Derived: G
Reference: Wayne Buchanan (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of S695
Forward Primer: A9019_F AGGAAGGTGTGAAGGATAGGC
Reverse Primer: A9019_R CTCAGGGGCTGTCAGGAAG
Reviews

Customers who bought this product also purchased
S695
S695
A10652
A10652
S691
S691
A6091
A6091
S764
S764
A10738
A10738
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies