Top » Catalog » SNPs » A9019

$18.00

A9019
[A9019]

A9019
hg38 Position: ChrY:11951846..11951846
Ancestral: C
Derived: G
Reference: Wayne Buchanan (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of S695
Forward Primer: A9019_F AGGAAGGTGTGAAGGATAGGC
Reverse Primer: A9019_R CTCAGGGGCTGTCAGGAAG
Reviews

Customers who bought this product also purchased
R1b-L1335 Scots Panel
R1b-L1335 Scots Panel
FGC32575
FGC32575
A9012
A9012
S695
S695
A10652
A10652
S691
S691
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies