Top » Catalog » SNPs » A6484

$18.00

A6484
[A6484]

A6484
hg38 Position: ChrY:3036804..3036804
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF13 > DF21 > S5488
Forward Primer: A6484_F AGGAATGCCCTTGAGACTCC
Reverse Primer: A6484_R CATTCAGACTTGCTTACAGATGC
Reviews

Customers who bought this product also purchased
Z245
Z245
L21
L21
FGC14589
FGC14589
Z253
Z253
DF19
DF19
Y113338
Y113338
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies