Top » Catalog » SNPs » A6484

$18.00

A6484
[A6484]

A6484
hg38 Position: ChrY:3036804..3036804
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF13 > DF21 > S5488
Forward Primer: A6484_F AGGAATGCCCTTGAGACTCC
Reverse Primer: A6484_R CATTCAGACTTGCTTACAGATGC
Reviews

Customers who bought this product also purchased
R1b-Z2103 Panel
R1b-Z2103 Panel
DF13
DF13
Z2103
Z2103
Z3004
Z3004
Z29644
Z29644
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies