Top » Catalog » SNPs » A6484

$18.00

A6484
[A6484]

A6484
hg38 Position: ChrY:3036804..3036804
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF13 > DF21 > S5488
Forward Primer: A6484_F AGGAATGCCCTTGAGACTCC
Reverse Primer: A6484_R CATTCAGACTTGCTTACAGATGC
Reviews

Customers who bought this product also purchased
CTS9219
CTS9219
L513
L513
DF99
DF99
M985
M985
DF27
DF27
Z2106
Z2106
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies