Top » Catalog » SNPs » A6486

$18.00

A6486
[A6486]

A6486
hg38 Position: ChrY:7200183..7200183
Ancestral: A
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF13 > DF21 > S5488
Forward Primer: A6486_F TGCCATGCTAGCAGAAGATG
Reverse Primer: A6486_R TTCTGTGGGCAGAGACCAG
Reviews

Customers who bought this product also purchased
R1b-S5488 Jamieson Panel
R1b-S5488 Jamieson Panel
A6496
A6496
A6502
A6502
A6495
A6495
A6501
A6501
A6490
A6490
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies