Top » Catalog » SNPs » A6490

$18.00

A6490
[A6490]

A6490
hg38 Position: ChrY:7967294..7967294
Ancestral: T
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF13 > DF21 > S5488
Forward Primer: A6490_F GGCTCATCCTATGACACTCTCTAG
Reverse Primer: A6490_R AGATTGTGACTCTCAATTAAACAACC
Reviews

Customers who bought this product also purchased
A6501
A6501
A6489
A6489
A6500
A6500
A6486
A6486
A6499
A6499
A6484
A6484
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies