Top » Catalog » SNPs » A6499

$18.00

A6499
[A6499]

A6499
hg38 Position: ChrY:16811716..16811716
Ancestral: T
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF13 > DF21 > S5488
Forward Primer: A6499_F TTGGTTGGTGGAGAGATGTG
Reverse Primer: A6499_R CGTGATCTGCCCACCTCC
Reviews

Customers who bought this product also purchased
A6495
A6495
A6502
A6502
A6490
A6490
A6501
A6501
A6489
A6489
A6500
A6500
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies