Top » Catalog » SNPs » A6502

$18.00

A6502
[A6502]

A6502
hg38 Position: ChrY:21262229..21262229
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF13 > DF21 > S5488
Forward Primer: A6502_F AGTCACCCTGGTGAATCTGG
Reverse Primer: A6502_R AATTCCCGAGAATCAATCCAC
Reviews

Customers who bought this product also purchased
A6486
A6486
A6498
A6498
A6484
A6484
A6496
A6496
A6503
A6503
R1b-S5488 Jamieson Panel
R1b-S5488 Jamieson Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies