Top » Catalog » SNPs » A6502

$18.00

A6502
[A6502]

A6502
hg38 Position: ChrY:21262229..21262229
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF13 > DF21 > S5488
Forward Primer: A6502_F AGTCACCCTGGTGAATCTGG
Reverse Primer: A6502_R AATTCCCGAGAATCAATCCAC
Reviews

Customers who bought this product also purchased
A6499
A6499
A6486
A6486
A6498
A6498
A6484
A6484
A6496
A6496
A6503
A6503
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies