Top » Catalog » SNPs » A6503

$18.00

A6503
[A6503]

A6503
hg38 Position: ChrY:21821760..21821760
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF13 > DF21 > S5488
Forward Primer: A6503_F GGTCAACCTGGCAAATTTC
Reverse Primer: A6503_R CGTCTCTTTTGCTCTCTGAAATCT
Reviews

Customers who bought this product also purchased
A6490
A6490
A6500
A6500
A6489
A6489
A6499
A6499
A6486
A6486
A6498
A6498
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies