Top » Catalog » SNPs » A16212

$18.00

A16212
[A16212]

A16212
hg38 Position: ChrY:7165725..7165725
Ancestral: A
Derived: C
Reference: William Hartley (2017)
ISOGG Haplogroup: I1-M253
Comments: Downstream I1-M253 Z63+ Y7626+ Branch
Forward Primer: A16212_F CATCAACAATAACAACAACAAATGG
Reverse Primer: A16212_R TAGCATTATGTTTTCAAGGAGTATTCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies