Top » Catalog » SNPs » FT180869

$18.00

FT180869
[FT180869]

FT180869
hg38 Position: ChrY:14841152..14841152
Ancestral: A
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: J1
Comments: Below FGC11 > ZS4753 > FGC48131 > Y170491
Forward Primer: FT180869_F CCTCTTCCTCAACATCTTAGCC
Reverse Primer: FT180869_R GTCCCTGGCTGAGCTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x HVR2
$25.00
Haplogroup Info
Other products
Currencies