Top » Catalog » SNPs » FT70801

$18.00

FT70801
[FT70801]

FT70801
hg38 Position: ChrY:8796967..8796967
Ancestral: T
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT70801_F TGTTCCTGGCGTGCATG
Reverse Primer: FT70801_R ATATGAGGCAAGTTAGTGGGAGATAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies