Top » Catalog » SNPs » YFS563951

$18.00

YFS563951
[YFS563951]

YFS563951
hg38 Position: ChrY:20015254..20015254
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: E
Comments: .
Forward Primer: YFS563951_F TCCAATAACAGCCTGCACTG
Reverse Primer: YFS563951_R CACGTCTTCCAAACAGTTTCC
Reviews

Customers who bought this product also purchased
YFS523972
YFS523972
A10164
A10164
A6111
A6111
YFS523985
YFS523985
A10163
A10163
A6110
A6110
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies