Top » Catalog » SNPs » YFS563951

$18.00

YFS563951
[YFS563951]

YFS563951
hg38 Position: ChrY:20015254..20015254
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: E
Comments: .
Forward Primer: YFS563951_F TCCAATAACAGCCTGCACTG
Reverse Primer: YFS563951_R CACGTCTTCCAAACAGTTTCC
Reviews

Customers who bought this product also purchased
A10160
A10160
A6107
A6107
A6112
A6112
YFS523972
YFS523972
A10164
A10164
A6111
A6111
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies