Top » Catalog » SNPs » FGC23559

$18.00

FGC23559
[FGC23559]

FGC23559
hg38 Position: ChrY:16677569..16677569
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: I1a1b1 (not listed)
Comments: .
Forward Primer: FGC23559_F AGGGTGCTGGGTGAAATATG
Reverse Primer: FGC23559_R TGAAATGCAGTGGCAGAATC
Reviews

Customers who bought this product also purchased
A7628
A7628
S7660
S7660
FGC43220
FGC43220
FGC17110
FGC17110
Y34377
Y34377
A7627
A7627
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies