Top » Catalog » SNPs » FGC23559

$18.00

FGC23559
[FGC23559]

FGC23559
hg38 Position: ChrY:16677569..16677569
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: I1a1b1 (not listed)
Comments: .
Forward Primer: FGC23559_F AGGGTGCTGGGTGAAATATG
Reverse Primer: FGC23559_R TGAAATGCAGTGGCAGAATC
Reviews

Customers who bought this product also purchased
FGC22110
FGC22110
FGC14508
FGC14508
FGC35957
FGC35957
FGC23548
FGC23548
FGC14507
FGC14507
FGC14515
FGC14515
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A4676
1 x A2089
$36.00
Haplogroup Info
Other products
Currencies