Top » Catalog » SNPs » FGC23559

$18.00

FGC23559
[FGC23559]

FGC23559
hg38 Position: ChrY:16677569..16677569
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: I1a1b1 (not listed)
Comments: .
Forward Primer: FGC23559_F AGGGTGCTGGGTGAAATATG
Reverse Primer: FGC23559_R TGAAATGCAGTGGCAGAATC
Reviews

Customers who bought this product also purchased
FGC23548
FGC23548
FGC14507
FGC14507
FGC14515
FGC14515
FGC35955
FGC35955
FGC23547
FGC23547
Y33772
Y33772
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies