Top » Catalog » SNPs » CTS6804

$18.00

CTS6804
[CTS6804]

CTS6804
hg38 Position: ChrY:15004769..15004769
Ancestral: G
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream CTS900 CTS3261
Forward Primer: CTS6804_F TGCCCATATACCCATATCATTTC
Reverse Primer: CTS6804_R GCTAACCTGTTTCATGTCAACC
Reviews

Customers who bought this product also purchased
L70
L70
PF5401
PF5401
FGC56143
FGC56143
Z7700
Z7700
Z8114
Z8114
Y3620
Y3620
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies