Top » Catalog » SNPs » FGC15901

$18.00

FGC15901
[FGC15901]

FGC15901
hg38 Position: ChrY:19016398..19016398
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: FGC15901_F CTCAGCACCCAGACAGACAC
Reverse Primer: FGC15901_R TAGGTTCATGTTGCCAGTGC
Reviews

Customers who bought this product also purchased
L24
L24
Z7532
Z7532
Z2227
Z2227
M47
M47
L26
L26
Z6065
Z6065
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies