Top » Catalog » SNPs » PF5196

$18.00

PF5196
[PF5196]

PF5196
hg38 Position: ChrY:16607631..16607631
Ancestral: G
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream PF5177
Forward Primer: PF5196_F AGTGTGTTGTCTTTAGAAATAAGGTG
Reverse Primer: PF5196_R AGGTTTCCCATGGATGCTAC
Reviews

Customers who bought this product also purchased
L24
L24
S19231
S19231
M67
M67
PF5174
PF5174
L26
L26
PF5172
PF5172
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies