Top » Catalog » SNPs » PF5196

$18.00

PF5196
[PF5196]

PF5196
hg38 Position: ChrY:16607631..16607631
Ancestral: G
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream PF5177
Forward Primer: PF5196_F AGTGTGTTGTCTTTAGAAATAAGGTG
Reverse Primer: PF5196_R AGGTTTCCCATGGATGCTAC
Reviews

Customers who bought this product also purchased
J2-M172 Superclade Panel
J2-M172 Superclade Panel
J2a-PF5197 Panel
J2a-PF5197 Panel
PF5183
PF5183
PF5197
PF5197
PF5177
PF5177
L24
L24
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies