Top » Catalog » SNPs » S12459

$18.00

S12459
[S12459]

S12459
hg38 Position: ChrY:9924848..9924848
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream Z7671
Forward Primer: S12459_F ATCTGGTAGTTTACTGCTGGAAAATAAGCTG
Reverse Primer: S12459_R CAACAGTAAACTATTGGACAAATATGTC
Reviews

Customers who bought this product also purchased
J2a-M67 Panel
J2a-M67 Panel
Y11202
Y11202
CTS6804
CTS6804
Z7671
Z7671
Y25813
Y25813
Z467
Z467
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies