Top » Catalog » SNPs » S18579

$18.00

S18579
[S18579]

S18579
hg38 Position: ChrY:14518218..14518218
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream M319
Forward Primer: S18579_F CAGGGTTTGTGCTCAGATCTAC
Reverse Primer: S18579_R TGGTGGCAGAGATTACCTTTC
Reviews

Customers who bought this product also purchased
L558
L558
FGC19515
FGC19515
Y5178
Y5178
Y5501
Y5501
Y5168
Y5168
Z39482
Z39482
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies