Top » Catalog » SNPs » FGC20770

$19.00

FGC20770
[FGC20770]

FGC20770
hg38 Position: ChrY:21088565..21088565
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b
Comments: Below DF27 > FGC20767
Forward Primer: FGC20770v2_F CCAATTGCATGTCAAAATGATG
Reverse Primer: FGC20770v2_R GAACAAAGCTAAGAAAACACTGGG
Reviews

Customers who bought this product also purchased
L51
L51
F1343
F1343
Y63240
Y63240
Z2103
Z2103
Z296
Z296
Y36418
Y36418
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies