Top » Catalog » SNPs » FGC20770

$18.00

FGC20770
[FGC20770]

FGC20770
hg38 Position: ChrY:21088565..21088565
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b
Comments: Below DF27 > FGC20767
Forward Primer: FGC20770v2_F CCAATTGCATGTCAAAATGATG
Reverse Primer: FGC20770v2_R GAACAAAGCTAAGAAAACACTGGG
Reviews

Customers who bought this product also purchased
U152
U152
Y31384
Y31384
M96
M96
DF19
DF19
Y34174
Y34174
M267
M267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies