Top » Catalog » SNPs » FGC20770

$18.00

FGC20770
[FGC20770]

FGC20770
hg38 Position: ChrY:21088565..21088565
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b
Comments: Below DF27 > FGC20767
Forward Primer: FGC20770v2_F CCAATTGCATGTCAAAATGATG
Reverse Primer: FGC20770v2_R GAACAAAGCTAAGAAAACACTGGG
Reviews

Customers who bought this product also purchased
M168
M168
Y107967
Y107967
L21
L21
Z225
Z225
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
FT162867
FT162867
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies