Top » Catalog » SNPs » FGC20770

$18.00

FGC20770
[FGC20770]

FGC20770
hg38 Position: ChrY:21088565..21088565
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b
Comments: Below DF27 > FGC20767
Forward Primer: FGC20770v2_F CCAATTGCATGTCAAAATGATG
Reverse Primer: FGC20770v2_R GAACAAAGCTAAGAAAACACTGGG
Reviews

Customers who bought this product also purchased
Z2103
Z2103
Z296
Z296
Y36418
Y36418
M70
M70
Z245
Z245
Y189528
Y189528
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies