Top » Catalog » SNPs » SK1336

$18.00

SK1336
[SK1336]

SK1336
hg38 Position: ChrY:14712338..14712338
Ancestral: T
Derived: C
Reference: Mark Stoneking and Ryan Wei (2014)
ISOGG Haplogroup: J2a1a1b*
Comments: Equal or downstream M67
Forward Primer: SK1336_F TCTTCCAAATCCAGAAATCG
Reverse Primer: SK1336_R CACAGAAGAGCAAGGACCAG
Reviews

Customers who bought this product also purchased
Y15915
Y15915
FGC3361
FGC3361
FGC21373
FGC21373
S25258
S25258
Z6272
Z6272
J2a-M67 Panel
J2a-M67 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies