Top » Catalog » SNPs » Y13640

$18.00

Y13640
[Y13640]

Y13640
hg38 Position: ChrY:15704896..15704896
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: Y13640_F TTCATGCTAAGCCTAGCTTTGG
Reverse Primer: Y13640_R CCCAGGTGACATATAAAATTAGTTGG
Reviews

Customers who bought this product also purchased
M92
M92
S12459
S12459
J2a-M67 Panel
J2a-M67 Panel
Y11202
Y11202
CTS6804
CTS6804
Z7671
Z7671
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies