Top » Catalog » SNPs » Y13640

$18.00

Y13640
[Y13640]

Y13640
hg38 Position: ChrY:15704896..15704896
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: Y13640_F TTCATGCTAAGCCTAGCTTTGG
Reverse Primer: Y13640_R CCCAGGTGACATATAAAATTAGTTGG
Reviews

Customers who bought this product also purchased
Z7671
Z7671
Y25813
Y25813
Z467
Z467
Y13654
Y13654
M92
M92
S12459
S12459
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies