Top » Catalog » SNPs » Z39482

$18.00

Z39482
[Z39482]

Z39482
hg38 Position: ChrY:8665529..8665529
Ancestral: A
Derived: G
Reference: Chris Rottensteiner (2015)
ISOGG Haplogroup: J2a1
Comments: S18115.FGC17716/Y5177(xFGC17720/Y5500)
Forward Primer: Z39482_F GCCCATTTGTGTGGTTCTG
Reverse Primer: Z39482_R ATGTGTAGTTGGGGGACCAC
Reviews

Customers who bought this product also purchased
Y5501
Y5501
Y5168
Y5168
FGC19515
FGC19515
S18579
S18579
Y5178
Y5178
Y23722
Y23722
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies