Top » Catalog » SNPs » Z458

$18.00

Z458
[Z458]

Z458
hg38 Position: ChrY:8700933..8700933
Ancestral: C
Derived: T
Reference: Bonnie Schrack (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream of M67. approximately equivalent to L227 & L218
Forward Primer: Z458_F CAAGAAGCCCCATCTGAAAG
Reverse Primer: Z458_R GGGCATGTGGTATTCTCAGG
Reviews

Customers who bought this product also purchased
A14266
A14266
F15834
F15834
L911
L911
FGC43516
FGC43516
Z482
Z482
L210
L210
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies