Top » Catalog » SNPs » Z458

$18.00

Z458
[Z458]

Z458
hg38 Position: ChrY:8700933..8700933
Ancestral: C
Derived: T
Reference: Bonnie Schrack (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream of M67. approximately equivalent to L227 & L218
Forward Primer: Z458_F CAAGAAGCCCCATCTGAAAG
Reverse Primer: Z458_R GGGCATGTGGTATTCTCAGG
Reviews

Customers who bought this product also purchased
Y15247
Y15247
CTS900
CTS900
Z2227
Z2227
L210
L210
mtComplete
mtComplete
Z30388
Z30388
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies