Top » Catalog » SNPs » Z6270

$18.00

Z6270
[Z6270]

Z6270
hg38 Position: ChrY:13015267..13015267
Ancestral: G
Derived: C
Reference: Ray Banks (2015)
ISOGG Haplogroup: J2 (not listed)
Comments: approx. downstream of J2a M67 (expected Z467- Z500- CTS3261- Z6271-)
Forward Primer: Z6270_F TTCTCCCACATTCCATCCTC
Reverse Primer: Z6270_R CCAGTCAACCCAGCAATCTC
Reviews

Customers who bought this product also purchased
Z7671
Z7671
J2a-M67 Panel
J2a-M67 Panel
PF5132
PF5132
M67
M67
Y16996
Y16996
CTS900
CTS900
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies