Top » Catalog » SNPs » Z6270

$18.00

Z6270
[Z6270]

Z6270
hg38 Position: ChrY:13015267..13015267
Ancestral: G
Derived: C
Reference: Ray Banks (2015)
ISOGG Haplogroup: J2 (not listed)
Comments: approx. downstream of J2a M67 (expected Z467- Z500- CTS3261- Z6271-)
Forward Primer: Z6270_F TTCTCCCACATTCCATCCTC
Reverse Primer: Z6270_R CCAGTCAACCCAGCAATCTC
Reviews

Customers who bought this product also purchased
CTS900
CTS900
Z28551
Z28551
Z467
Z467
Y4036
Y4036
M92
M92
Z7671
Z7671
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies