Top » Catalog » SNPs » FGC20764

$18.00

FGC20764
[FGC20764]

FGC20764
hg38 Position: ChrY:16692544..16692544
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27. aka V3505. Attention: flanked by a dinucleotide repeat
Forward Primer: FGC20764_F GATATTGACCAAAGCAAATCCTG
Reverse Primer: FGC20764_R AACCAAGAAAGCTCTTTGGTTTC
Reviews

Customers who bought this product also purchased
DF99
DF99
S355
S355
FGC20770
FGC20770
M207
M207
BY172255
BY172255
M168
M168
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies