Top » Catalog » SNPs » FGC20764

$18.00

FGC20764
[FGC20764]

FGC20764
hg38 Position: ChrY:16692544..16692544
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27. aka V3505. Attention: flanked by a dinucleotide repeat
Forward Primer: FGC20764_F GATATTGACCAAAGCAAATCCTG
Reverse Primer: FGC20764_R AACCAAGAAAGCTCTTTGGTTTC
Reviews

Customers who bought this product also purchased
BY15279
BY15279
FGC30984
FGC30984
CTS9952
CTS9952
Y34187
Y34187
FGC30962
FGC30962
Y12470
Y12470
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies