Top » Catalog » SNPs » FGC20764

$18.00

FGC20764
[FGC20764]

FGC20764
hg38 Position: ChrY:16692544..16692544
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27. aka V3505. Attention: flanked by a dinucleotide repeat
Forward Primer: FGC20764_F GATATTGACCAAAGCAAATCCTG
Reverse Primer: FGC20764_R AACCAAGAAAGCTCTTTGGTTTC
Reviews

Customers who bought this product also purchased
FT44481
FT44481
Y139205
Y139205
BY186642
BY186642
PH2054
PH2054
S2292
S2292
Y134946
Y134946
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies