Top » Catalog » SNPs » S2122

$18.00

S2122
[S2122]

S2122
hg38 Position: ChrY:14144217..14144217
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I1a2a1b (not listed)
Comments: Below Z73
Forward Primer: S2122_F AGAATAAGACAAATCTGGGTGAGG
Reverse Primer: S2122_R CAATACTCCTTTTCCCTTAAAAGGAC
Reviews

Customers who bought this product also purchased
Z2041
Z2041
L1302
L1302
Y25790
Y25790
Z59
Z59
I1-Z2539 (including L1302) Panel
I1-Z2539 (including L1302) Panel
BY479
BY479
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies